The Yamnaya Steppe Herders from Russia

Table 1
Alleles at the polymorphic site -13910 in the lactase gene in 10 Middle Neolithic Scandinavian samples representing the Pitted Ware Culture (PWC).

The ability to drink milk as an adult occurs at a high frequency in present-day populations that practice dairying and cattle rearing [1, 2, 3, 4]. It has been suggested that this correlation represents a case of gene-culture co-evolution, i.e. an adaptive genetic trait exposed to positive selection induced by cultural practices. The -13910*T allele associated with this trait in Europeans appears to have been the target of strong selection over a relatively short period of time [5, 6]. Such selection pressure could be one of several explanations for the high frequency of the derived allele (associated with allowing milk consumption in adulthood) in northern Europeans, the region where the allele is most common (74% in Sweden [7]). A single nucleotide polymorphism (SNP-13910 T/C), strongly associated with the ability to digest lactose in adulthood [8], has been used as a marker for the genetic trait. Notably, the allele frequency at the SNP and the extent of haplotype homozygosity around the particular SNP-allele indicate a history of a strong positive selection [5, 6, 9, 10], and it has been suggested that this selective pressure was attributable to the introduction of agriculture and animal domestication [10, 11].

The Pitted Ware Culture (PWC) was a major Neolithic hunter-gatherer population in Northern Europe and was partly contemporaneous with the farming TRB population (TRB after the German word Trichterbecherkultur, i.e Funnel Beaker Culture). The PWC are thought to have been present in Scandinavia between 5,400-4,300 years before present (BP) [12], which is later than the suggested initiation of selection for the T allele [6]. In this study, we find that the frequency of the derived allele is low in the PWC (5%) compared to the frequency in the extant Swedish population, and that the change in frequency is incompatible with genetic drift as the sole explanation under a model of population continuity. Thus, a genetic component interacting with culture, such as the ability to digest milk as an adult, could have been the result of the replacement of the hunter-gatherer population by an agricultural population. Alternatively, positive selection could have dramatically increased the frequency of the derived allele in the PWC, allowing for population continuity from the PWC to the extant Swedish population.


Figure 1
Map of Scandinavia showing the archaeological sites. 1. Ajvide, 2. Visby, 3. Fritorp, 4. Ire.

DNA was extracted from approximately 100 mg of bone powder pre-treated with bleach [14]. The samples were extracted in a laboratory specially dedicated to aDNA work at the Archaeological Research Laboratory in Stockholm, as well as in a newly built ancient DNA facility at the National Board of Forensic Medicine in Linköping that is separated from the department's PCR areas. The samples were extracted at least twice, and both water blanks and extracts from contemporary prehistoric seals were included as negative controls. The DNA extractions were performed using the method of Yang et al. [15].

To screen for DNA content indicating authenticity, real-time PCR was performed on the selected samples as well as on 98 negative controls (where 31 were DNA extracts from ancient non human mammals representing the same context as the selected samples and 67 were water blanks). An 80 bp fragment in the mitochondria was targeted (L4567F 3'CACTGATTTTTTACCTGAGTAGGCCT5', H4595R 3'CGAGGGTTTATTTTTTTGGTTAGAACT5'), and amplifications were carried out according to a previously described protocol [14].


Figure 2
Real-time PCR quantitative data for the 10 samples and 98 negative controls, where 31 were nonhuman mammals and 67 were water controls or PCR controls.

The C/T polymorphism at position -13910 upstream from the lactase gene was amplified by two different fragments, a shorter 53 bp fragment and a longer 168 bp fragment. The two sets of primers shared the biotinylated forward primer (5'→3' GCTGGCAATACAGATAAGATAATG), but had different reverse primers for the 53 bp fragment (5'→3'GAGGAGAGTTCCTTTGAGGC), and the 168 bp fragment (5'→3' ATGCCCTTTCGTACTACTCCC).

The system was originally set up to detect differences in preservation and authenticity of the material analyzed, relying on the fragmentation level [14]. The PCR amplification was carried out using 5 μl of extract, 300 nM of each primer and the Illustra Hot Start Ready-To-Go mix (GE Healthcare Life Sciences). The PCR profile was 15 min at 95°C, followed by 43 cycles of 30 s at 94°C, 30 s at 54.6°C and 30 s at 72°C, with a final extension step of 15 min at 72°C. Pyrosequencing was used for allele identification. The sequencing primers were designed to anneal next to the SNP (5'→3'CCTTTGAGGCCAGGG). The pyrosequencing was performed according to supplier provided protocols, and as previously described in [16].


Figure 3
Frequency of the -13910*T polymorphic site in the lactase gene in three datasets: an extant Swedish population, a Swedish Neolithic hunter-gatherer population (PWC) and the negative controls.

The fourteen specimens all yielded replicable results and ten of these were successfully SNP-typed a minimum of four times (using both the 53 bp and the 168 bp fragment). Thus, even with thorough mitochondrial pre-selection, the success rate for the nuclear DNA sequences was down to 71%. As only one individual was heterozygote, it is not possible to calculate an allelic dropout rate, but from the four pyrosequencing results from the heterozygote individual, two replicate typing events expressed allelic dropout. A low number of positive results were detected in the negative controls, eight of the 59 Neolithic seals, seven of the 53 negative extraction controls and eight of the 47 PCR negative controls. In total, 14% of the negative controls were contaminated, and out of these, the frequency of the T allele was 52%. None of the contaminants could however be reproduced. The allele frequency in the negative controls was significantly different from the allele frequency in the ten archaeological samples used for further analysis (Fisher's Exact test, p < 0.001). The contamination frequency is in direct contrast to that of the short mitochondrial fragment, where 86% of the negative controls (98 negative controls, where 31 were nonhuman mammals and 67 water controls or PCR controls) expressed contamination, although to a more than 1000-fold lower quantity than the ancient human samples (Figure 2).

Only one of the ten PWC individuals showed a presence of the T allele, a heterozygote, and the allele frequency for the T allele is 0.05 (1/20, with the exact 95% CI values 0.001265089 to 0.2487328, Figure 3). The T allele frequency in the PWC population differs significantly from the T allele frequency in the contemporary Swedish population (n = 97, Fisher's Exact test, p < 0.0001), where the frequency of the T allele is 0.74 (144/194, with the exact 95% CI values 0.6747198 to 0.8022533, Figure 3).



Here we describe a possible scenario where cultural practices could have had a tremendous impact on the genetic composition of human populations. Before dairy farming was practiced in Scandinavia, the allele frequency at -13910 was not greatly affected. The neolithisation processes in Scandinavia provided a selection pressure on this specific locus on a scale that may actually have led to a population replacement in the area (as indicated by mitochondrial DNA [13]), or at least a major shift in the allele frequency at this particular locus. This would require that cultural changes were dependent upon demographic changes in this case, and that cattle farming presented a clear advantage to hunting/gathering. In such case the 'secondary product revolution' (i.e. the introduction of milk) in northern Europe would have a large effect on the derived allele at -13910. Thus, the development that led to the present-day North European lifestyle, which is heavily based on dairy and other farm products, may have been a process where cultural practices and genes interacted.

It is unlikely that the PWC and their ancestors used dairy products before the middle Neolithic, nor is there any archaeological evidence for such practices [25]. The difference in allele frequency from the extant Scandinavian population may therefore be explained by the fact that PWC is not ancestral to the extant Scandinavian population. An alternative, but less likely, explanation posits an ancestral relationship, but with selection dramatically increasing the frequency of the derived allele.

BMC Evolutionary Biology201010:89